ID: 917509110_917509119

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 917509110 917509119
Species Human (GRCh38) Human (GRCh38)
Location 1:175655680-175655702 1:175655727-175655749
Sequence CCCACCACCATTAGCAAAGAAAC TGTTCTGGTCATTTCCAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 187} {0: 1, 1: 0, 2: 0, 3: 15, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!