ID: 917516789_917516794

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 917516789 917516794
Species Human (GRCh38) Human (GRCh38)
Location 1:175714978-175715000 1:175715023-175715045
Sequence CCCTTCTACTCTCTCCCAGGCTC AAACCATGCTTCTCAAAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 491} {0: 1, 1: 1, 2: 21, 3: 161, 4: 783}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!