ID: 917589633_917589640

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 917589633 917589640
Species Human (GRCh38) Human (GRCh38)
Location 1:176463025-176463047 1:176463046-176463068
Sequence CCGTGATAGTCCGGGAACACCCA CAAATTGGTGTAAAAATGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43} {0: 1, 1: 0, 2: 3, 3: 49, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!