ID: 917596550_917596557

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 917596550 917596557
Species Human (GRCh38) Human (GRCh38)
Location 1:176534984-176535006 1:176535024-176535046
Sequence CCTGTGTTCCTTGTGCTCTGGTT AACCAGAGGGAGACTGTAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 252} {0: 1, 1: 0, 2: 1, 3: 23, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!