ID: 917609114_917609117

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 917609114 917609117
Species Human (GRCh38) Human (GRCh38)
Location 1:176668265-176668287 1:176668285-176668307
Sequence CCTTATCTAGAGCATAGAGAGCA GCATGAGGAAAGGTAGATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125} {0: 1, 1: 0, 2: 0, 3: 14, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!