ID: 917610006_917610011

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 917610006 917610011
Species Human (GRCh38) Human (GRCh38)
Location 1:176679579-176679601 1:176679611-176679633
Sequence CCTTCTCTTTTCACAGGGCATGA CCACTTGACCCAAGGGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 17, 4: 370} {0: 2, 1: 0, 2: 2, 3: 18, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!