ID: 917612078_917612089

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 917612078 917612089
Species Human (GRCh38) Human (GRCh38)
Location 1:176699161-176699183 1:176699212-176699234
Sequence CCTGTACCACATGAACATGACGG GGAGCTGCTCTTCCAACACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 53} {0: 1, 1: 0, 2: 0, 3: 19, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!