ID: 917618187_917618195

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 917618187 917618195
Species Human (GRCh38) Human (GRCh38)
Location 1:176767800-176767822 1:176767852-176767874
Sequence CCAAACGTGCTGTCACCTCAGGC GGTCGTGATCACAAGACAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 562} {0: 1, 1: 0, 2: 1, 3: 6, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!