ID: 917638613_917638614

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 917638613 917638614
Species Human (GRCh38) Human (GRCh38)
Location 1:176960661-176960683 1:176960685-176960707
Sequence CCTGATAGCTGATGGCTTCTTCT CTTCTTTTTTCACCAAACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 215} {0: 1, 1: 0, 2: 1, 3: 27, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!