ID: 917644360_917644361

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 917644360 917644361
Species Human (GRCh38) Human (GRCh38)
Location 1:177015562-177015584 1:177015575-177015597
Sequence CCAGAAGAATCATCTACAATTCC CTACAATTCCACATTTATTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 157} {0: 1, 1: 0, 2: 3, 3: 33, 4: 445}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!