ID: 917654409_917654418

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 917654409 917654418
Species Human (GRCh38) Human (GRCh38)
Location 1:177112091-177112113 1:177112134-177112156
Sequence CCCTCCTCTATATGTGCAATCTG AGAATGTTTTGCTTTTTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 134} {0: 1, 1: 0, 2: 3, 3: 36, 4: 553}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!