ID: 917661572_917661578

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 917661572 917661578
Species Human (GRCh38) Human (GRCh38)
Location 1:177181884-177181906 1:177181899-177181921
Sequence CCCCGGCCGCAGAGGCGCAGGCG CGCAGGCGGGATTCTTGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 197} {0: 1, 1: 0, 2: 0, 3: 8, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!