ID: 917670671_917670678

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 917670671 917670678
Species Human (GRCh38) Human (GRCh38)
Location 1:177270589-177270611 1:177270637-177270659
Sequence CCTGTCCTCCTCTTTGGGTCACA GCTTCCTTCTTTCCTGGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 200} {0: 1, 1: 0, 2: 0, 3: 28, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!