ID: 917755416_917755424

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 917755416 917755424
Species Human (GRCh38) Human (GRCh38)
Location 1:178093850-178093872 1:178093880-178093902
Sequence CCGCGGAGCAGGAGCCAGAGCTG AGCTGTGGCCTGAGAGTCAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 63, 4: 462} {0: 1, 1: 0, 2: 2, 3: 41, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!