ID: 917755416_917755427

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 917755416 917755427
Species Human (GRCh38) Human (GRCh38)
Location 1:178093850-178093872 1:178093885-178093907
Sequence CCGCGGAGCAGGAGCCAGAGCTG TGGCCTGAGAGTCAGGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 63, 4: 462} {0: 1, 1: 1, 2: 2, 3: 55, 4: 416}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!