ID: 917755419_917755431

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 917755419 917755431
Species Human (GRCh38) Human (GRCh38)
Location 1:178093864-178093886 1:178093906-178093928
Sequence CCAGAGCTGTGGCCGGAGCTGTG GGCAGGCTCATTCCAGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 301} {0: 1, 1: 0, 2: 3, 3: 9, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!