ID: 917764138_917764140

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 917764138 917764140
Species Human (GRCh38) Human (GRCh38)
Location 1:178199004-178199026 1:178199022-178199044
Sequence CCTACTCAAGTAATGGTGGACAC GACACCTCCTCCAGCCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 49} {0: 1, 1: 0, 2: 3, 3: 28, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!