ID: 917764138_917764146

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 917764138 917764146
Species Human (GRCh38) Human (GRCh38)
Location 1:178199004-178199026 1:178199044-178199066
Sequence CCTACTCAAGTAATGGTGGACAC GCTGCCCTGCAGTTCGATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 49} {0: 1, 1: 9, 2: 47, 3: 79, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!