ID: 917770319_917770322

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 917770319 917770322
Species Human (GRCh38) Human (GRCh38)
Location 1:178269934-178269956 1:178269950-178269972
Sequence CCAGTAGGGTATTTTTCCTGATT CCTGATTAGCAGTTCGTGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 383} {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!