ID: 917779787_917779795

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 917779787 917779795
Species Human (GRCh38) Human (GRCh38)
Location 1:178381305-178381327 1:178381342-178381364
Sequence CCTGCCATAATCTGCATGAGAAG ATTAGGATGGTGGATGGTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95} {0: 1, 1: 0, 2: 2, 3: 35, 4: 382}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!