ID: 917789441_917789453

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 917789441 917789453
Species Human (GRCh38) Human (GRCh38)
Location 1:178490146-178490168 1:178490199-178490221
Sequence CCAAGAGCTGTGCACAGTCCTCT GATGCTGGCCCCCAGGTCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 309} {0: 1, 1: 0, 2: 1, 3: 21, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!