ID: 917856035_917856040

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 917856035 917856040
Species Human (GRCh38) Human (GRCh38)
Location 1:179100821-179100843 1:179100838-179100860
Sequence CCCCTTCAACACGCCAGCTGCTC CTGCTCCCTCAGAGTGAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114} {0: 1, 1: 0, 2: 0, 3: 14, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!