|
Left Crispr |
Right Crispr |
| Crispr ID |
917862995 |
917863000 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:179165954-179165976
|
1:179165981-179166003
|
| Sequence |
CCCAGCTAATTTTTTGTATTCAC |
GAGACGGGGTTTTACCATGTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 17, 2: 980, 3: 24546, 4: 76887} |
{0: 1762, 1: 44253, 2: 143111, 3: 151661, 4: 87100} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|