ID: 917862995_917863001

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 917862995 917863001
Species Human (GRCh38) Human (GRCh38)
Location 1:179165954-179165976 1:179165990-179166012
Sequence CCCAGCTAATTTTTTGTATTCAC TTTTACCATGTTGGCCAGATTGG
Strand - +
Off-target summary {0: 1, 1: 17, 2: 980, 3: 24546, 4: 76887} {0: 7, 1: 672, 2: 16242, 3: 148219, 4: 205199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!