ID: 917863766_917863770

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 917863766 917863770
Species Human (GRCh38) Human (GRCh38)
Location 1:179173943-179173965 1:179173980-179174002
Sequence CCTACCTTCTCAAGAAAACCCTG TACTTGCAAGAAAAAGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 14, 4: 187} {0: 1, 1: 0, 2: 7, 3: 140, 4: 1147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!