|
Left Crispr |
Right Crispr |
| Crispr ID |
917894761 |
917894765 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:179477344-179477366
|
1:179477383-179477405
|
| Sequence |
CCCAAGACTGGGCAATTTACAAA |
GTCTCACAGTTCCACGTGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 669, 1: 2285, 2: 5340, 3: 12814, 4: 14384} |
{0: 4, 1: 629, 2: 4728, 3: 7886, 4: 8230} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|