|
Left Crispr |
Right Crispr |
| Crispr ID |
917895985 |
917895990 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:179487716-179487738
|
1:179487746-179487768
|
| Sequence |
CCAGGCGTGATGGCTCATGCCTG |
ACACTTTGTAAGGCCAAGGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 206, 1: 7388, 2: 47444, 3: 131710, 4: 192178} |
{0: 2, 1: 185, 2: 4980, 3: 49505, 4: 161322} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|