ID: 917967555_917967563

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 917967555 917967563
Species Human (GRCh38) Human (GRCh38)
Location 1:180188079-180188101 1:180188103-180188125
Sequence CCCCAGAGAACTAAAGCACCTTG CAGGGTCTTCCAGCTAGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 263} {0: 1, 1: 0, 2: 2, 3: 38, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!