ID: 917968819_917968836

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 917968819 917968836
Species Human (GRCh38) Human (GRCh38)
Location 1:180194660-180194682 1:180194706-180194728
Sequence CCCGCCTCCCCTGCTCCGTCTTC CTGCTAGGGCAGAGGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 75, 4: 821} {0: 1, 1: 0, 2: 3, 3: 43, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!