ID: 917968908_917968914

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 917968908 917968914
Species Human (GRCh38) Human (GRCh38)
Location 1:180195009-180195031 1:180195032-180195054
Sequence CCAGGGCGGAGCCGAGGTTAAAG GAGCTGAATGGAGCAGGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55} {0: 1, 1: 1, 2: 2, 3: 42, 4: 483}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!