ID: 917981267_917981274

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 917981267 917981274
Species Human (GRCh38) Human (GRCh38)
Location 1:180271249-180271271 1:180271270-180271292
Sequence CCCCTGTGCCTCGCGCTGTCCTG TGCCTACAGCAGGCAGGCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 408} {0: 1, 1: 0, 2: 2, 3: 26, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!