ID: 917985124_917985127

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 917985124 917985127
Species Human (GRCh38) Human (GRCh38)
Location 1:180308767-180308789 1:180308788-180308810
Sequence CCAGTTAGAGTGTTTGCTCACCC CCATTTACCGCTATAGATACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 63} {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!