ID: 918009045_918009053 |
View in Genome Browser |
Spacer: 30 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 918009045 | 918009053 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:180569470-180569492 | 1:180569523-180569545 |
| Sequence | CCCTAGAGCCTCTGGAGGGAGTG | TAATATTGGTTTCAGACTCCTGG |
| Strand | - | + |
| Off-target summary | {0: 6, 1: 33, 2: 134, 3: 326, 4: 845} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||