ID: 918013672_918013676

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 918013672 918013676
Species Human (GRCh38) Human (GRCh38)
Location 1:180611481-180611503 1:180611505-180611527
Sequence CCTGCCTTCAGCTGCTAAAGAGG AGTGACATGGAGAAGCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 143} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!