ID: 918043618_918043634

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 918043618 918043634
Species Human (GRCh38) Human (GRCh38)
Location 1:180928040-180928062 1:180928083-180928105
Sequence CCAGCCCAACAACCCCGGGCCCT TAGCTCCTGCTGTCTGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 228} {0: 1, 1: 0, 2: 5, 3: 32, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!