ID: 918045626_918045633

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 918045626 918045633
Species Human (GRCh38) Human (GRCh38)
Location 1:180939305-180939327 1:180939345-180939367
Sequence CCATCTGCTCTCCAGAACTTCAG CTCCTGGACATCTCCATCAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 57, 4: 329} {0: 1, 1: 0, 2: 0, 3: 17, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!