ID: 918058664_918058668

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 918058664 918058668
Species Human (GRCh38) Human (GRCh38)
Location 1:181044257-181044279 1:181044283-181044305
Sequence CCGGCCTGATCTTTTTTCTTAAC ATGCTTATAAATGAGGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 21, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!