ID: 918064389_918064412

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 918064389 918064412
Species Human (GRCh38) Human (GRCh38)
Location 1:181089524-181089546 1:181089577-181089599
Sequence CCCCCCGCGCCGCCCGCGGTGTG CGGCGGCCCAGCGGGCTGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 167} {0: 1, 1: 0, 2: 3, 3: 30, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!