ID: 918069511_918069520

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 918069511 918069520
Species Human (GRCh38) Human (GRCh38)
Location 1:181124592-181124614 1:181124614-181124636
Sequence CCTCCCTCCTCCTCCTCCTTCTG GCTTTGTTTTCTTCTGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 28, 2: 274, 3: 1483, 4: 5608} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!