ID: 918071724_918071733

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 918071724 918071733
Species Human (GRCh38) Human (GRCh38)
Location 1:181138173-181138195 1:181138226-181138248
Sequence CCTGCTGGGTTTGGTGAGGATGA TCCAGGATGGACATGCCATTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!