ID: 918098878_918098881

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 918098878 918098881
Species Human (GRCh38) Human (GRCh38)
Location 1:181356594-181356616 1:181356615-181356637
Sequence CCAGCAGGCCTTCAGGGAGAAGA GAGAGCCAGGTCTGCTCTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 29, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!