ID: 918126030_918126035

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 918126030 918126035
Species Human (GRCh38) Human (GRCh38)
Location 1:181584773-181584795 1:181584806-181584828
Sequence CCTACCACCTCCTCCACATTATA TCAAAACTAATTTGACAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 299} {0: 1, 1: 0, 2: 3, 3: 38, 4: 486}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!