ID: 918128577_918128580

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 918128577 918128580
Species Human (GRCh38) Human (GRCh38)
Location 1:181605399-181605421 1:181605412-181605434
Sequence CCATGCCCAAGGCAGCACTGGCA AGCACTGGCAGCTCAAGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 326} {0: 1, 1: 0, 2: 1, 3: 14, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!