ID: 918142709_918142724

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 918142709 918142724
Species Human (GRCh38) Human (GRCh38)
Location 1:181732541-181732563 1:181732579-181732601
Sequence CCGCTCAATGCCCACCCCAGCCT GGCCATTGAGGGCCTGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 591} {0: 1, 1: 0, 2: 6, 3: 40, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!