ID: 918145960_918145967

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 918145960 918145967
Species Human (GRCh38) Human (GRCh38)
Location 1:181756058-181756080 1:181756103-181756125
Sequence CCTCTTCACCGTCTCCACAGGGG TGAGTTGTCATGCTTGTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 142} {0: 1, 1: 0, 2: 1, 3: 13, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!