ID: 918210231_918210235

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 918210231 918210235
Species Human (GRCh38) Human (GRCh38)
Location 1:182343896-182343918 1:182343912-182343934
Sequence CCTAAATCCAATCTGACTGGTGT CTGGTGTTCTTAAAGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 99, 2: 551, 3: 1361, 4: 2147} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!