ID: 918227451_918227452

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 918227451 918227452
Species Human (GRCh38) Human (GRCh38)
Location 1:182497168-182497190 1:182497188-182497210
Sequence CCTACATCAATGTGAACTGCTTC TTCTTGTCCTTCTTTATGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 175} {0: 1, 1: 0, 2: 5, 3: 26, 4: 412}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!