ID: 918236139_918236140

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 918236139 918236140
Species Human (GRCh38) Human (GRCh38)
Location 1:182582443-182582465 1:182582471-182582493
Sequence CCACTTAGTTTTATGAAGAGTAA ACATATAAGTCACAGTTGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 275} {0: 1, 1: 1, 2: 0, 3: 14, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!