ID: 918269124_918269127

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 918269124 918269127
Species Human (GRCh38) Human (GRCh38)
Location 1:182879176-182879198 1:182879202-182879224
Sequence CCTTGCTGCAAAAAGTTTATTAA CTGTGTATACACAAGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 323} {0: 1, 1: 0, 2: 0, 3: 44, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!