ID: 918306116_918306121

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 918306116 918306121
Species Human (GRCh38) Human (GRCh38)
Location 1:183248471-183248493 1:183248490-183248512
Sequence CCCTCAAGACCATGTGGATCCAG CCAGCTGAATCCTCAGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 125} {0: 1, 1: 0, 2: 1, 3: 34, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!